ID: 902213061_902213065

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902213061 902213065
Species Human (GRCh38) Human (GRCh38)
Location 1:14917406-14917428 1:14917428-14917450
Sequence CCCCCAGGAGTGGACGGAGATGA ACAGTCTCCATAGAGATAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121} {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!