ID: 902214043_902214052

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902214043 902214052
Species Human (GRCh38) Human (GRCh38)
Location 1:14923761-14923783 1:14923797-14923819
Sequence CCTCTCCCGGTCAGCTGTGGGGA CAAGGCTGTCACAGGGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175} {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!