ID: 902214805_902214814

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902214805 902214814
Species Human (GRCh38) Human (GRCh38)
Location 1:14927833-14927855 1:14927849-14927871
Sequence CCCTCCCCTTTACATGAAACCCG AAACCCGCGGTTGAGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98} {0: 1, 1: 0, 2: 0, 3: 9, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!