ID: 902222922_902222925

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 902222922 902222925
Species Human (GRCh38) Human (GRCh38)
Location 1:14978203-14978225 1:14978224-14978246
Sequence CCTGAATCAGAGCTTTTCTTCAA AAGATCTTCATGGCTCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236} {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!