ID: 902233679_902233691

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 902233679 902233691
Species Human (GRCh38) Human (GRCh38)
Location 1:15044233-15044255 1:15044268-15044290
Sequence CCGACTCACATCGGAGACCTAGG GGGCAGAGCAGAACACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 46} {0: 1, 1: 0, 2: 1, 3: 46, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!