ID: 902244885_902244891

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902244885 902244891
Species Human (GRCh38) Human (GRCh38)
Location 1:15114303-15114325 1:15114334-15114356
Sequence CCTCAACCTCCCTGAGCAGGGAG CTAATAGGAGGAGCACACAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 409} {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!