ID: 902259885_902259891

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902259885 902259891
Species Human (GRCh38) Human (GRCh38)
Location 1:15216861-15216883 1:15216877-15216899
Sequence CCATCAAATGTTGTGGCTGTGGG CTGTGGGATTGGAGAGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146} {0: 1, 1: 0, 2: 1, 3: 49, 4: 540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!