|
Left Crispr |
Right Crispr |
| Crispr ID |
902260117 |
902260124 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:15218834-15218856
|
1:15218861-15218883
|
| Sequence |
CCTCAATTTGCATTAACCCACCC |
ATTTGCATGTGACTAAAAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 12, 2: 24, 3: 40, 4: 113} |
{0: 2, 1: 2, 2: 101, 3: 240, 4: 465} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|