ID: 902272922_902272928

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 902272922 902272928
Species Human (GRCh38) Human (GRCh38)
Location 1:15317489-15317511 1:15317524-15317546
Sequence CCCTTTAGATTGAACTCAAAAAT CAGGGTTTCAAGTGAGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 405} {0: 1, 1: 0, 2: 2, 3: 10, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!