ID: 902274132_902274140

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 902274132 902274140
Species Human (GRCh38) Human (GRCh38)
Location 1:15327045-15327067 1:15327097-15327119
Sequence CCTCTCTGCTGCAGCTGGAGCAC TGGACGGGCGAAGCCGTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 44, 4: 320} {0: 1, 1: 0, 2: 0, 3: 5, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!