ID: 902275854_902275868

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 902275854 902275868
Species Human (GRCh38) Human (GRCh38)
Location 1:15338731-15338753 1:15338784-15338806
Sequence CCAGGTGAATGATCTCCCCCTCC GCAGTCACTCACATGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 207, 4: 3093} {0: 1, 1: 0, 2: 2, 3: 16, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!