ID: 902292678_902292685

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 902292678 902292685
Species Human (GRCh38) Human (GRCh38)
Location 1:15445564-15445586 1:15445578-15445600
Sequence CCTGGTGGCTTATGCCCTCCCGG CCCTCCCGGTCTGGTGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94} {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!