ID: 902302903_902302907

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 902302903 902302907
Species Human (GRCh38) Human (GRCh38)
Location 1:15515284-15515306 1:15515327-15515349
Sequence CCTTACACTTCAAGCAAATGCAG TGTCTGTTTCTCTGCTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 163} {0: 1, 1: 0, 2: 2, 3: 64, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!