ID: 902304366_902304370

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 902304366 902304370
Species Human (GRCh38) Human (GRCh38)
Location 1:15525139-15525161 1:15525154-15525176
Sequence CCCAAGGCGGCACCTCCGCGACT CCGCGACTCGCCCCGCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29} {0: 1, 1: 0, 2: 4, 3: 39, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!