ID: 902306920_902306926

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902306920 902306926
Species Human (GRCh38) Human (GRCh38)
Location 1:15547895-15547917 1:15547917-15547939
Sequence CCCCACTACCTCTCATGTCACTG GTGACATGAGACGGAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 210} {0: 1, 1: 0, 2: 1, 3: 17, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!