ID: 902325836_902325840

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 902325836 902325840
Species Human (GRCh38) Human (GRCh38)
Location 1:15700146-15700168 1:15700161-15700183
Sequence CCCCTAAATCCTGCAGAGCCCCA GAGCCCCATCGCTGAAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210} {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!