ID: 902329246_902329259

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902329246 902329259
Species Human (GRCh38) Human (GRCh38)
Location 1:15723016-15723038 1:15723066-15723088
Sequence CCTGAGCTCACTCTGGCAGCTCA ACCTGGAGGAAGGCAGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 217} {0: 1, 1: 0, 2: 1, 3: 49, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!