ID: 902332380_902332399

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 902332380 902332399
Species Human (GRCh38) Human (GRCh38)
Location 1:15736889-15736911 1:15736932-15736954
Sequence CCCTCCACCATCCCATGACCCAG CCTCCAAAGGCAGGGCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 605} {0: 1, 1: 0, 2: 5, 3: 44, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!