ID: 902334396_902334402

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 902334396 902334402
Species Human (GRCh38) Human (GRCh38)
Location 1:15746786-15746808 1:15746806-15746828
Sequence CCTGTGGAGGGTGGGTCAGGGAG GAGCAGGGAGGTCCAGTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 368} {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!