ID: 902334543_902334558

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 902334543 902334558
Species Human (GRCh38) Human (GRCh38)
Location 1:15747471-15747493 1:15747498-15747520
Sequence CCCGGGTCACTGGAGGCCCAAGG CAGGGGGATGGGTGAATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 274} {0: 1, 1: 1, 2: 10, 3: 169, 4: 1475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!