ID: 902340663_902340664

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902340663 902340664
Species Human (GRCh38) Human (GRCh38)
Location 1:15781565-15781587 1:15781583-15781605
Sequence CCTGGAAGGAGTTGAGTGCTGTT CTGTTAACTAAGAAGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 263} {0: 1, 1: 0, 2: 4, 3: 69, 4: 637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!