ID: 902375523_902375530

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 902375523 902375530
Species Human (GRCh38) Human (GRCh38)
Location 1:16028435-16028457 1:16028448-16028470
Sequence CCCTCCTGCCCCGGAGATGCACA GAGATGCACATGGCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 163} {0: 1, 1: 0, 2: 2, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!