ID: 902383013_902383020

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902383013 902383020
Species Human (GRCh38) Human (GRCh38)
Location 1:16061430-16061452 1:16061481-16061503
Sequence CCCATGCCCAGCTGCTTCAGGTG GGAGAACCGCCCTGAGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 222} {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!