ID: 902398455_902398465

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 902398455 902398465
Species Human (GRCh38) Human (GRCh38)
Location 1:16144834-16144856 1:16144883-16144905
Sequence CCGGACCTCAGTTTCCTCATCTG CTCTGGGTTGTGTGTGAAGATGG
Strand - +
Off-target summary {0: 10, 1: 111, 2: 530, 3: 1527, 4: 3312} {0: 1, 1: 0, 2: 1, 3: 16, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!