ID: 902404947_902404960

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 902404947 902404960
Species Human (GRCh38) Human (GRCh38)
Location 1:16177474-16177496 1:16177527-16177549
Sequence CCACCATGACCTGGTGCACCATT GTCATGCCAGGATTCATGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!