ID: 902449973_902449983

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902449973 902449983
Species Human (GRCh38) Human (GRCh38)
Location 1:16490844-16490866 1:16490866-16490888
Sequence CCCTCCCTGTTGTGCCCCCACCT TCTGCGGCTCCTCCTCCAGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 39, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!