ID: 902449975_902449983

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 902449975 902449983
Species Human (GRCh38) Human (GRCh38)
Location 1:16490848-16490870 1:16490866-16490888
Sequence CCCTGTTGTGCCCCCACCTCTGC TCTGCGGCTCCTCCTCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 561} {0: 1, 1: 1, 2: 4, 3: 39, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!