ID: 902450029_902450043

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 902450029 902450043
Species Human (GRCh38) Human (GRCh38)
Location 1:16491066-16491088 1:16491110-16491132
Sequence CCGAGTACCTCTTCTTGTACTGG GATGGTGACCCCCATGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 0, 3: 9, 4: 99} {0: 1, 1: 0, 2: 3, 3: 21, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!