|
Left Crispr |
Right Crispr |
| Crispr ID |
902461629 |
902461633 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:16581807-16581829
|
1:16581850-16581872
|
| Sequence |
CCAGGAACAGGTTTGGTGTCCTG |
CTCATTCTTTCTCTTAGGAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 13, 3: 15, 4: 154} |
{0: 13, 1: 4, 2: 4, 3: 32, 4: 305} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|