ID: 902464568_902464580

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 902464568 902464580
Species Human (GRCh38) Human (GRCh38)
Location 1:16608070-16608092 1:16608098-16608120
Sequence CCAGGACAGTGTAGGAGCCTTAG GGGATGCAGGTGGACAGGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 99} {0: 3, 1: 6, 2: 10, 3: 81, 4: 870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!