ID: 902465291_902465300

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902465291 902465300
Species Human (GRCh38) Human (GRCh38)
Location 1:16613609-16613631 1:16613645-16613667
Sequence CCAAGGCGCAGGCGCGGCGGGGC GGCGGCCTCTTCTGCACAACGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 6, 3: 26, 4: 245} {0: 1, 1: 1, 2: 0, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!