ID: 902472505_902472510

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902472505 902472510
Species Human (GRCh38) Human (GRCh38)
Location 1:16658448-16658470 1:16658484-16658506
Sequence CCGGTGCCGGGCAGCGGTGGGTG GCCCACAGCGCCCCCAGCCCTGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 7, 3: 85, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!