ID: 902479411_902479426

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 902479411 902479426
Species Human (GRCh38) Human (GRCh38)
Location 1:16703885-16703907 1:16703937-16703959
Sequence CCCAGCAGTCTGGCTTCAGTCTG ACTCACCACGTGGAGGGTGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!