ID: 902479415_902479428

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902479415 902479428
Species Human (GRCh38) Human (GRCh38)
Location 1:16703912-16703934 1:16703950-16703972
Sequence CCCTCCCCCTCTTCCTCCTGGGC AGGGTGCTGGCCCTTGATGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 10, 3: 204, 4: 2063} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!