ID: 902482228_902482233

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 902482228 902482233
Species Human (GRCh38) Human (GRCh38)
Location 1:16718031-16718053 1:16718067-16718089
Sequence CCAGCCTGGCAACCACAGAAAGA GTCGAGTCACATGCTGCTGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!