ID: 902486293_902486300

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 902486293 902486300
Species Human (GRCh38) Human (GRCh38)
Location 1:16748961-16748983 1:16748998-16749020
Sequence CCCAGGGCTGGGGGCGCTGTGGG CACCCACCGCTGCCCGGCACTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 5, 3: 86, 4: 624} {0: 3, 1: 0, 2: 1, 3: 12, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!