ID: 902486508_902486516

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 902486508 902486516
Species Human (GRCh38) Human (GRCh38)
Location 1:16750167-16750189 1:16750186-16750208
Sequence CCCCCTACAGAGGCCTGAGCCTG CCTGCCTTCCCAGGAGGCCCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 34, 4: 217} {0: 4, 1: 2, 2: 8, 3: 80, 4: 753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!