|
Left Crispr |
Right Crispr |
| Crispr ID |
902493616 |
902493619 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:16853968-16853990
|
1:16853981-16854003
|
| Sequence |
CCCAAGGACAGGAATCCAGTGGT |
ATCCAGTGGTAGCCTGTTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 5, 2: 3, 3: 18, 4: 203} |
{0: 2, 1: 0, 2: 6, 3: 11, 4: 131} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|