ID: 902495261_902495263

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902495261 902495263
Species Human (GRCh38) Human (GRCh38)
Location 1:16867918-16867940 1:16867949-16867971
Sequence CCAAAACATTTTTGGGGGTGACT CTCCAAAAATCTTCCATAAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 140} {0: 5, 1: 0, 2: 2, 3: 17, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!