ID: 902505418_902505428

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 902505418 902505428
Species Human (GRCh38) Human (GRCh38)
Location 1:16936685-16936707 1:16936730-16936752
Sequence CCAGGAGGCGGGCCTGGGACTGA GAGCCGGGCCGAGGCAGCCCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 59, 4: 1446} {0: 1, 1: 1, 2: 4, 3: 29, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!