ID: 902506775_902506786

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902506775 902506786
Species Human (GRCh38) Human (GRCh38)
Location 1:16943819-16943841 1:16943870-16943892
Sequence CCTAGCTCGGCCTCTTCTACCTG CTCCATCCACTCCAAGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 329} {0: 1, 1: 2, 2: 0, 3: 12, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!