ID: 902517801_902517808

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 902517801 902517808
Species Human (GRCh38) Human (GRCh38)
Location 1:16999036-16999058 1:16999083-16999105
Sequence CCTGTGCCATCTGGAATCTTTAT GAAACAGCTCAGATGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175} {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!