ID: 902519764_902519770

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 902519764 902519770
Species Human (GRCh38) Human (GRCh38)
Location 1:17009620-17009642 1:17009643-17009665
Sequence CCGGCCTCATGCTGATCCTCCTA CCTCAGCCTCCCAAAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 265} {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!