ID: 902525104_902525109

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 902525104 902525109
Species Human (GRCh38) Human (GRCh38)
Location 1:17052104-17052126 1:17052145-17052167
Sequence CCCAAAGTGCTGGAATTACAGGC CAAGATACACACTTTTAAGTAGG
Strand - +
Off-target summary {0: 8353, 1: 231656, 2: 273926, 3: 181702, 4: 144141} {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!