ID: 902546514_902546519

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 902546514 902546519
Species Human (GRCh38) Human (GRCh38)
Location 1:17193826-17193848 1:17193842-17193864
Sequence CCAGAGGTGTTCTTCCCAGAAAA CAGAAAAGAGAGCAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 194} {0: 1, 1: 0, 2: 10, 3: 110, 4: 981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!