ID: 902551504_902551512

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 902551504 902551512
Species Human (GRCh38) Human (GRCh38)
Location 1:17222298-17222320 1:17222320-17222342
Sequence CCAAGGGTGCCAACAGCTTCAGG GGTCTCTGGAAGCTCCGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 203} {0: 1, 1: 1, 2: 1, 3: 18, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!