|
Left Crispr |
Right Crispr |
| Crispr ID |
902558932 |
902558938 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:17264893-17264915
|
1:17264914-17264936
|
| Sequence |
CCCAGCCTCAGGAGGCTGAAGTG |
TGGGAGGATTACTTGAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 16, 3: 126, 4: 678} |
{0: 519, 1: 15379, 2: 47381, 3: 85254, 4: 130263} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|