|
Left Crispr |
Right Crispr |
| Crispr ID |
902558932 |
902558940 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:17264893-17264915
|
1:17264923-17264945
|
| Sequence |
CCCAGCCTCAGGAGGCTGAAGTG |
TACTTGAGCCCAGGAGGCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 16, 3: 126, 4: 678} |
{0: 39, 1: 1846, 2: 24218, 3: 71925, 4: 134909} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|