ID: 902577246_902577252

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 902577246 902577252
Species Human (GRCh38) Human (GRCh38)
Location 1:17386177-17386199 1:17386201-17386223
Sequence CCCCCATGCTTCTGTTTAATGGG ACAACAAATGCCTGCTTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154} {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!