ID: 902579471_902579483

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 902579471 902579483
Species Human (GRCh38) Human (GRCh38)
Location 1:17399100-17399122 1:17399138-17399160
Sequence CCTCAGTGAGCTGCGCCCCCAGT TGTGAGGCCCACTTCGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 201} {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!